Epigenetik

Epigenetik

Reversible epigenetische Prozesse

Epigenetische Vorgänge sind bei Pflanzen, Tieren und Menschen auf vielfältige Weise beschrieben worden. Ein bekanntes und eindrückliches Beispiel ist die Differenzierung bei Bienen im Larvenstadium. Hier ist ein hochentwickeltes System zur epigenetischen Modifikation zu finden. Alle Bienenlarven sind genetisch gleich und werden in der Regel (unfruchtbare) Arbeiterinnen. Wird eine Biene ab dem vierten Lebenstag mit Gelee royal gefüttert, so wird sie eine Königin: genetisch gleich und zugleich langlebiger, größer und vor allem fruchtbar. Werden erwachsene Arbeiterinnen mit Gelee royal gefüttert, so hat dies keinerlei Auswirkung (Wang et al. 2006, Maleszka 2008). Dies ist ein Beispiel für eine über Ernährung vermittelte epigenetische Programmierung zu einem sensiblen Zeitfenster. Auf molekularer Ebene ist das sehr vereinfacht folgendermaßen vorstellbar:

Zur Erinnerung: Wenn ich mir eine Zelle vorstelle, so hat sie zunächst eine Zellmembran, sozusagen ihre Haut. Im Zellinneren befinden sich im Zytoplasma, der Zellflüssigkeit, ihre Zellorganellen und ihr Zellkern. Im Zellkern liegt die DNA, die die Gene enthält. Die DNA kann man sich als eine Abfolge der Buchstaben A,C,G und T vorstellen[1], beispielsweise: AAACGCCTTGCGTAATGCAGTTCG… Eine bestimmte Abfolge ist der Code für ein Gen. Kommt nun beispielsweise ein Signalmolekül, wie ein Hormon, von außen an die Zellmembran und trifft dort auf einen passenden Rezeptor, so erfolgt in der Regel eine Enzymkaskade oder innere Signalkette – so ähnlich wie Domino – in der Zelle. Sie kann dazu führen, dass am Ende ein bestimmtes Gen abgelesen wird. Das bedeutet, dass erst ein passendes Signalmolekül an eine bestimmte DNA-Sequenz des Gens bindet und dann eine Kopie des Gens in Form einer RNA angefertigt wird (Transkription). Diese RNA wird ins Zytoplasma transportiert und dient dort als Vorlage für ein Protein (Translation). Ein Protein ist eine Kette von Aminosäuren, die durch die Abfolge der Basen ACGT bestimmt wird. Das Protein kann dann z.B. das Verhalten der Zelle beeinflussen, was für Stoffe sie produziert, wohin sie sich bewegt, was für Rezeptoren sie in ihre Zellmembran einbaut und unvorstellbar viel mehr. Sehr vereinfacht funktioniert Genexpression also so: Signal à DNA à RNA à Protein à Verhalten.

Epi bedeutet „zudem/außerdem“ und beschreibt zusätzliche Funktionsweisen, die Verfügbarkeit von Genen zur Genexpression zu beeinflussen, ohne dass die DNA-Sequenz, also die Basenabfolge, verändert wird. Es gibt viele verschiedene solcher Funktionsweisen und die Anzahl der Neuentdeckungen wächst stetig. Die bekannteste Art ist die DNA-Methylierung. Hier werden Methylgruppen, also CH3-Gruppen, „zudem/außerdem“ an die Basen ATCG, meist das C, angehängt. Daraufhin werden diese DNA-Bereiche „stillgelegt“ und sind damit für Signalmoleküle unerreichbar. Epigenetische Vorgänge sind prinzipiell – im Vergleich zu der Abfolge der Basenpaare, die in der Regel gleich bleibt – reversibel. Das heißt, Methylgruppen können das ganze Leben lang angefügt und abgelöst werden. Dies geschieht besonders häufig oder in großem Maß zu bestimmten sensiblen Zeitfenstern in der Entwicklung, wie rund um Konzeption und Geburt, oder durch Langzeiteinwirkungen, wie bei lang anhaltendem Stress während der Schwangerschaft oder anderer Lebensphasen. Wie weiter unten anhand einer Studie beschrieben wird, ist zum Beispiel der Grad der Stressempfindlichkeit von Kindern „sensibel“ auf mütterliches Verhalten und „reversibel“ durch mütterliches Verhalten.

Ausnahmen dieser Reversibilität sind unter anderem die Zelldifferenzierungen in der Embryonalentwicklung, für die epigenetische Vorgänge essentiell sind. Die allerersten Zellen nach der Konzeption sind noch pluripotente Stammzellen[2], die sich in jede spezialisierte Zelle entwickeln können. Im Verlauf der Entwicklung geschehen epigenetische Prozesse und es entstehen immer weiter differenzierte Zellen, wie multipotente Zellen[3] und dann spezialisierte Lungen-, Herz-, Nervenzellen usw.. Diese Vorgänge sind in der Regel nicht reversibel.[4]

[1] Das sind die Abkürzungen der sogenannten Basen Adenin, Cytosin, Guanin und Thymin. Sie liegen sich in zwei komplementären Strängen in der sogenannten Doppelhelixstruktur gegenüber: wenn in einem Strang ein A liegt, findet sich im anderen ein T, und einem C liegt ein G gegenüber.
[2] Pluripotente Stammzellen können embryonale und extraembryonale Gewebe wie Nabelschnur und Plazenta bilden. Nach der Differenzierung in Embryoblast und Trophoblast, gehen aus den Zellen des Embryoblasten embryonale Gewebe hervor und aus denen des Trophoblasten die extraembryonalen Gewebe.
[3] Die Zellen des Embryoblasten bilden drei Zellschichten aus –  die sogenannten drei Keimblätter: das Ekto-,Meso- und Endoderm – aus denen jeweils verschiedene Organe gebildet werden. In diesem Stadium werden sie als multipotent bezeichnet und sie können nur noch “ihre” Organe bilden.
[4] Im Labor gibt es Erfolge und einen Nobelpreis dafür, bereits differenzierte Zellen durch die Aufhebung epigenetischer Markierungen zu embryonalen Stammzellen (ESCs) zurück zu differenzieren: „In 2006, we showed that stem cells with properties similar to ESCs could be generated from mouse fibroblasts by simultaneously introducing four genes (Takahashi and Yamanaka, 2006). We designated these cells iPSCs. In 2007, we reported that a similar approach was applicable for human fibroblasts and that by introducing a handful of factors, human iPSCs can be generated (Takahashi et al., 2007). On the same day, James Thomson’s group also reported the generation of human iPSC using a different combination of factors (Yu et al., 2007).” (Yamanaka, 2012, S.678)

 

Exemplarische epigenetische Studien zu präkonzeptionellen, konzeptionellen, pränatalen, perinatalen und postnatalen Auswirkungen auf die Kinder:

 

Epigenetische Einflüsse vor der Konzeption

Dias, B. G. & Ressler, K. J. (2014). Parental olfactory experience influences behavior and neural structure in subsequent generations. Nature neuroscience,17(1), 89-96.

Dieser viel zitierte Artikel zeigt an Ratten, wie eine traumatische Erfahrung des zukünftigen Vaters VOR der Konzeption über die männliche Keimbahn an die folgenden Generationen weitergegeben wird. Die Kinder und Enkelkinder zeigten entsprechendes Verhalten, als hätten sie das Trauma selbst erlebt, in ihrer DNA waren signifikante Methylierungsunterschiede nachweisbar, und die Neuroanatomie zeigte signifikante Veränderungen. Die Unterschiede zeigten sich sowohl bei natürlicher Befruchtung, bei künstlicher Befruchtung als auch dann, wenn die Kinder direkt nach der Geburt zu „Pflegeeltern“ ohne Traumatisierung gegeben wurden.

Genauer betrachtet, wurden männliche Ratten drei verschiedenen Gruppen zugeordnet. Die erste Gruppe blieb „zu Hause“ in ihren Käfigen (zu Hause Väter). Die zweite wurde auf den Geruchsreiz Acetopheron aversiv konditioniert (Ace-Väter), d.h. die Tiere erlebten zeitgleich mit dem Geruch einen künstlich erzeugten Schock, und die dritte Gruppe dasselbe mit dem Geruchsreiz Propanol (Prop-Väter). Daraufhin wurden die Väter dieser drei Gruppen mit jungfräulichen nicht traumatisierten weiblichen Ratten verpaart (F0-Generation). Die männlichen Nachkommen (F1), wurden wiederum mit jungfräulichen untraumatisierten weiblichen Tieren verpaart. Deren Nachkommen (F2) sind dann also die Enkelkinder der ersten Eltern-Generation (F0).
Im Verhalten und der Neuroanatomie der Kinder und Enkelkinder waren signifikante Unterschiede zwischen denen von „zu Hause Eltern“ und denen von „mit Ace- bzw. Prop- traumatisierten Eltern“ zu finden. Die Nachkommen zeigten aversives Verhalten auf die Geruchsreize, bei denen ihre Väter ein Schockerlebnis hatten. In ihren Glomeruli – den Neuronenstrukturen, die die Gerüche verarbeiten – waren je nach Ace- oder Prop-Vater, anatomische Veränderungen  zu sehen.
Der epigenetische Status der Gene der Geruchsrezeptoren in den Spermien der männlichen Nachkommen (F1) (also die Zellen der zukünftigen F2 Generation) zeigten signifikante Unterschiede in der Methylierung zwischen der Ace-Gruppe und der Prop-Gruppe.

Zusammengefasst zeigt diese Studie, wie Erlebnisse von Eltern vor der Konzeption Einfluss auf die DNA-Methylierung, die Neuroanatomie und das Verhalten ihrer Kinder und Kindeskinder hatten, auch wenn die Kinder gleich nach der Geburt zu Pflegeeltern ohne diese Erlebnisse kamen. Das heißt, die Kinder konnten sich das entsprechende aversive Verhalten auf einen bestimmten Geruchsreiz nicht  von ihren Eltern „abgeguckt“ haben, sondern haben auf einem anderen Weg „davon erfahren“. Mit verschiedenen Tieren ist gezeigt worden, dass epigenetische Mechanismen bis zur dritten Generation erhalten bleiben können (Heard & Martienssen 2014). Mit Menschen sind diese Art Studien schwierig, da sie nur unter strikt kontrollierbaren Bedingungen von z.B. Verpaarung und Haltung erfolgen können, da sich jegliche Veränderungen in Umgebung oder Lebensstil auch spontan auf das Epigenom auswirken können.


 

Während der Konzeption

Hiura, H. et al. (2012) Characterization of DNA methylation errors in patients with imprinting disorders conceived by assisted reproduction technologies. Human Reproduction 27.8: 2541-2548.

Der Vergleich zwischen natürlicher Empfängnis und assistierter reproduktiver Technologien (ART) ermöglicht es, einen Eindruck zu bekommen, welchen Einfluss diese Zeit auf das kindliche Epigenom hat. Die Untersuchung von Hiura et al. beschreibt Methylierungsveränderungen im Vergleich von natürlicher zu artifizieller Konzeption in Patienten mit Imprinting-Syndromen. Imprinting ist ein epigenetischer Vorgang während der Gametogenese (Keimzelldifferenzierung) und Imprinting-Störungen sind im Allgemeinen sehr seltene Erkrankungen.

Imprinting bedeutet die Prägung von mütterlichen bzw. väterlichen Genen durch epigenetische Prozesse während der Gametogenese oder auch später. Jedes Gen liegt doppelt vor, einmal als mütterliches und einmal als väterliches Allel, wobei je nach Dominanz sich eines auswirkt. Bei geprägten Genen bestimmt die Herkunft der Gene die Ausprägung: Manche Gene sind nur aktiv, wenn sie von der Mutter kommen, andere nur vom Vater. Diese Gene sind auch von der frühen embryonalen Demethylierung in den ersten Tagen nach der Konzeption ausgenommen.[1]

In der bundesweiten epidemiologischen Studie in Japan in 2009 wurden Menschen mit einem der vier bekannten Imprinting-Syndrome[2] untersucht. Die Ergebnisse zeigten, dass zwei dieser Defekte (BWS und SRS) bei ART-Konzeption 10-fach häufiger auftraten als bei natürlicher Konzeption, und dass die ART-Fälle veränderte DNA-Methylierung an vielen verschiedenen geprägten Genorten aufwiesen.

Eine Vielzahl an Studien, berichtet über die Erhöhung von Imprinting-Defekten und Methylierungsveränderungen in Zusammenhang mit ART-Prozeduren. Reviews, die den Stand der Forschung sichten und zusammenfassen, kommen zu dem Schluss, dass es bei Menschen viele Hinweise auf Einflüsse durch ART Prozeduren gibt, wobei sie noch nicht überall als signifikante Beweise gelten, da u.a. der parentale Hintergrund der Infertilität als Einflussgröße nicht ausgeschlossen werden kann. In Tiermodellen sind Methylierungsveränderungen durch ART Prozeduren wie z.B. Superovulation und in vitro Kulturen nachgewiesen worden und gelten als anerkannt. In der Zusammenschau der Hinweise und Evidenzen wird auf erhöhte Achtsamkeit und die Dringlichkeit weiterer Forschung hingewiesen.[3]

[1] In den ersten Tagen nach der Konzeption erfolgt eine Demethylierung der embryonalen DNA (Monk 2015) wobei nicht alle Methylgruppen entfernt werden und ab dem fünften Tag auch neue Methylierungen erfolgen.
[2] Angelman syndrome (AS),  Beckwith-Wiedemann syndrome (BWS), Silver-Russell syndrome (SRS) und Prader-Willi syndrome (PWS)
[3] Vgl. bsp. Chiba et al. 2013, Cortessis et al. 2018, Jiang et al. 2018, Lazaraviciute et al. 2014, Kochanski et al. 2013, Shufaru & Laufer 2014, Ventura-Junca et al. 2015.

 

Während der pränatalen Entwicklung

Cao-Lei, L. et al. (2014) DNA methylation signatures triggered by prenatal maternal stress exposure to a natural disaster: Project Ice Storm.” PloS one 9.9: e107653.

Die ersten und inzwischen sehr bekannten und beinahe historischen Studien, die untersuchten wie Umweltfaktoren auf die Gesundheit folgender Generationen wirken, sind die Överkalix-Studien (Golding et al. 2001, Prembrey et al. 2006) und die Folgen des Niederländischen Hungerwinters (Heijmans et al. 2008). Auch wenn sie an die heutigen Standards geforderter molekularer Daten nicht mehr heranreichen, haben sie eine bemerkenswerte Bewegung vieler Kohorten-Studien und Untersuchungen an Tiermodellen in Gang gesetzt.

Der exemplarische Artikel von Cao-Lei et al. aus der Kohorte des Eissturms von Quebec 1998 untersucht, wie der pränatale objektiv gemessene Notstand der Mütter während des Eissturms, bei den Kindern im Alter von dreizehn Jahren mit DNA-Methylierungsgraden korrelierte.

Fünf Monate nach dem Eissturm wurden Frauen rekrutiert, die während des Eissturms schwanger waren. Es wurde der Grad ihres objektiven Notstandes und ihres subjektiven Stressempfindens erhoben. Dreizehn Jahre später wurde bei den Kindern das Methylierungsprofil untersucht. Der Grad des objektiven Notstandes korrelierte mit dem Grad an DNA-Methylierung an 1675 Genorten in 957 Genen, die hauptsächlich in die Immunabwehr involviert sind. In zwei Genen waren die Veränderungen in verschiedenen Zelltypen, wie T-Zellen, peripheren mononuklearen Blutzellen und Speichelzellen vergleichbar.

Dies zeigt, wie pränataler mütterlicher Stress möglicherweise weitreichende epigenetische Folgen für die Kinder in verschiedenen Geweben haben kann. Diese Studie fokussiert sich auf den objektiv messbaren Stress durch eine Naturkatastrophe. Eine Vielzahl von Studien untersucht die Auswirkungen von mütterlichem subjektiv empfundenen Stress bzw. Depressionen während der Schwangerschaft und berichtet u.a. über Zusammenhänge zwischen mütterlichem Stress, Methylierungsmustern und kindlicher Stressempfindlichkeit.[1]

[1] Vgl. bsp. Monk et al. 2012, 2016, Nemoda & Szyf 2017, Sosnowski et al. 2018

 

Während der Geburt

Almgren, M. et al. (2014) Cesarean delivery and hematopoietic stem cell epigenetics in the newborn infant: implications for future health? American Journal of Obstetrics & Gynecology 211.5: 502-e1.

Der Vergleich zwischen vaginaler Geburt und Kaiserschnitt kann Hinweise auf mögliche Einflüsse auf das kindliche Epigenom geben. Almgren et al. untersuchten DNA-Methylierung in den blutbildenden Stammzellen des Nabelschnurbluts von Neugeborenen nach vaginaler Geburt im Vergleich zu Kaiserschnittgeburten und fanden genomweite Methylierungsunterschiede.

Sie berichten von drei neuen Funden. Erstens eine signifikant höhere globale Methylierung der DNA dieser Zellen (+2%) bei mit Kaiserschnitt als bei vaginal geborenen Kindern. Zweitens identifizierte die Untersuchung orts-spezifischer DNA-Methylierung 343 Genloci mit signifikanten Methylierungsunterschieden von 10% oder mehr. Die Mehrheit dieser differenziell methylierten Genorte (76%) waren in den Blutstammzellen nach vaginaler Geburt hypermethyliert, wiesen also eine höhere Methylierung auf. Drittens korrelierte bei den vaginal geborenen Kindern der Grad der Methylierung an drei Genloci mit der Dauer der Wehen.

Diese Studie zeigt, wie Erlebnisse oder Umstände während der Geburt auf molekularbiologischer Ebene in den Körperzellen Spuren hinterlassen können. Die EPIgenetic Impact of Childbirth (EPIIC) Hypothese geht davon aus, dass unterschiedlicher Stress während der Geburt auf die epigenetische Regulation von Immunfunktionen unterschiedlich wirkt. Aktuelle Reviews beleuchten das noch junge Forschungsfeld (bsp. Dahlen et al. 2016, Ortiz et al. 2018, Tribe et al.2018).


 

Nach der Geburt

Weaver, Ian CG, et al. “Epigenetic programming by maternal behavior.” Nature neuroscience 7.8 (2004): 847.

Ein Highlight in der Literatur über epigenetische Programmierung ist eine Studie mit Ratten aus dem Jahr 2004. Es gibt Mütter, die ihre Kinder viel stillen, lecken und putzten, und solche die es von sich aus wenig tun. Die Studie untersuchte Methylierungsmuster eines Genbereichs, der an der Stressregulierung beteiligt ist, in Gehirngewebe der Rattenkinder dieser “verschiedenen Muttertypen”. Viel Kuscheln nach der Geburt bewirkte geringe Methylierung und geringe Stressempfindlichkeit der Kinder. Wenig “Kuschelerfahrung” in der ersten Woche führte zu hoher Methylierung und hoher Stressempfindlichkeit. Wurden die Jungen nach der Geburt zu einer anderen Mutter des gleichen Kuscheltyps gegeben, so blieb das Muster stabil. Wurden sie zu einer Mutter des anderen Kuscheltyps gegeben, so wurde das Muster zu ca. 70-80% umgedreht und an die Pflegemutter angepasst.

Genauer betrachtet wurde die Promotorregion des Gens eines Glukokortikoidrezeptors im Hippokampus untersucht. Der Hippokampus ist eine Struktur im Gehirn, ein Promotor ist der Genbereich an den Signalmoleküle binden können, um die Transkription eines Gens zu starten (DNAàRNA), und Glukokortikoide sind Stresshormone, die von der Nebenniere ausgeschüttet werden. Treffen sie im Gehirn auf entsprechende Rezeptoren, dann wird über eine  Signalkette über mehrere Zellen die weitere Ausschüttung in der Nebenniere gebremst. Je mehr Glukokortikoidrezeptoren in den Hippokampuszellen sind, desto effektiver ist die Herunterregulierung der Stressantwort. Ist der Promotor der Rezeptorgens methyliert, so ist es stillgelegt. Dann gibt es weniger Rezeptoren, weniger Rückkopplung und die Stressantwort wird weniger gebremst und ist höher. Die Rattenkinder die viel gekuschelt wurden zeigten geringere Methylierung und eine geringere Stressantwort. Egal, ob die eigene oder eine andere Mutter sie nach der Geburt genährt und gepflegt hat. Bei den Kindern der wenig kuschelnden Mütter war es genau umgekehrt. Die Unterschiede erschienen in der ersten Lebenswoche, wurden durch postnatales cross-fostering aufgehoben, blieben bis ins Erwachsenenalter stabil und waren mit Unterschieden in weiteren epigenetischen Funktionsweisen, wie Histonacetylierung, verbunden.

Diese Studie zeigt, wie das gestillt, geleckt und geputzt werden von Kindern in ihrer ersten Lebenswoche den epigenetischen Status eines ihrer Gene und damit ihre Stressempfindlichkeit beeinflusst, und dass dies potentiell reversibel ist. Es ist weiterhin gezeigt worden, wie die Stressresistenz beeinflusst wird, und dass die mütterliche Fürsorge auch noch einen Östrogenrezeptor beeinflusst (Champagne et al. 2006, 2009). Ähnliche Untersuchungen gibt es inzwischen auch bei Menschen (Murgatroyed et al. 2015). Die Stillforschung untersucht neben Auswirkungen des Stillens auf globale Methylierung und Methylierungsmuster verschiedener Gene auch epigenetische Mechanismen, die Informationen über die Muttermilch an das Kind weitergeben.[1]

[1] Vgl. bsp. Melnik et al. 2013, Hartwig et al. 2017, Verduci et al. 2014.

Zusammengefasst sind für alle fünf Zeitfenster Studien mit epigenetischen Befunden in Tiermodellen und/ oder bei Menschen zu finden. Die Aufmerksamkeit und die Ressourcen, die in die Erforschung der Auswirkung von Geschehnissen und Erlebnissen in dieser frühen Entwicklungszeit fließen sind riesig. Die internationale epigenetische Forschung sieht und vermutet hier offensichtlich große Einflüsse, und gleichzeitig ist das Geschehen so komplex, dass es kaum erfassbar oder auf aussagekräftige Ergebnisse reduzierbar ist: terra incognita, ein unerforschter Boden, auf dem es noch mehr zu entdecken gibt als bekannt ist.


 

Referenzen

Abbott, P. W., Gumusoglu, S. B., Bittle, J., Beversdorf, D. Q., & Stevens, H. E. (2018). Prenatal stress and genetic risk: How prenatal stress interacts with genetics to alter risk for psychiatric illness. Psychoneuroendocrinology90, 9-21.
Ainsworth, M. D., Blehar, M. C., Waters, E., & Wall, S. (1978). Patterns of attachment: Assessed in the strange situation and at home. Hillsdale, NJ:Erlbaum.
Almgren, M., Schlinzig, T., Gomez-Cabrero, D., Gunnar, A., Sundin, M., Johansson, S., … & Ekström, T. J. (2014). Cesarean delivery and hematopoietic stem cell epigenetics in the newborn infant: implications for future health?. American journal of obstetrics and gynecology211(5), 502-e1.
Almqvist, C., Cnattingius, S., Lichtenstein, P., & Lundholm, C. (2012). The impact of birth mode of delivery on childhood asthma and allergic diseases–a sibling study. Clinical & Experimental Allergy42(9), 1369-1376.
Alukal, J. P., & Lamb, D. J. (2008). Intracytoplasmic Sperm Injection (ICSI)–What are the Risks? Urologic Clinics of North America35(2), 277-288.
Amitay, E. L., & Keinan-Boker, L. (2015). Breastfeeding and childhood leukemia incidence: a meta-analysis and systematic review. JAMA pediatrics169(6), e151025-e151025.
Andersson, N. W., Hansen, M. V., Larsen, A. D., Hougaard, K. S., Kolstad, H. A., & Schlünssen, V. (2016). Prenatal maternal stress and atopic diseases in the child: a systematic review of observational human studies. Allergy71(1), 15-26.
Aßmann, B. (2008). Self-organization in Spontaneous Movements of Human Neonates: A Look on the Very Beginning of Embodied Cognition. VDM Publishing.
Aßmann B. (2010) Übereinstimmung und Neugier als Voraussetzung der Entwicklung: Bewegungsorganisation von Neugeborenen in Autonomie und Verbindung. In Wulf C & Gebauer K (eds), Bewegung und Emotion, Paragrana 19/1. Berlin. Akademie.
Aßmann B. (2013) Attachment in motion: a kinematic analysis of the exploratory behaviour of infants relating to their attachment styles. EECERA. Tallinn 2013.
Aßmann, B. (2018) Rosa oder Blau. Geschlechtskonstruktion in der frühkindlichen Entwicklung. In Koreuber, M. & Aßmann B., Das Geschlecht in der Biologie. Anregungen zu einem Perspektivwechsel. Nomos. Im Druck.
Aßmann B., Harms J., Kollek J., & Loscher D. (2008) Spontaneous symmetric phase-relations in Four-Limb Coordination of Human Neonates. Conference Proceedings of the Internationalen Society of Human Ethologie (ISHE) Bologna 2008.
Aßmann B. & Neumeister A. Phase relations in spontaneous movements of neonates. In Vorbereitung.
Aßmann, B., Käse, T., Vollbrecht, S., Eckrodt C., Buchheim A. & Niemitz C. Kinematic Analysis of Attachment and Exploratory Behavior of Infants and Toddlers. In Vorbereitung.
Ayers, S. (2004). Delivery as a traumatic event: prevalence, risk factors, and treatment for postnatal posttraumatic stress disorder. Clinical Obstetrics and Gynecology47(3), 552-567.
Ayers, S. (2017). Birth trauma and post-traumatic stress disorder: the importance of risk and resilience.  Journal of Reproductive and Infant Psychology, 35:5, 427-430.
Baby Friendly Health Initiative (2017) 10 steps to successful breastfeeding. http://www.tensteps.org/, letzter Zugriff 23.08.2018.
Bahrick. L.E. & Lickliter, R. (2012) The role of intersensory redundancy in early perceptual, cognitive, and social development. Multisensory development. 183–206
Barker D. J., Osmond C. (1986). Infant mortality, childhood nutrition, and ischaemic heart disease in England and Wales. 327 1077–1081. 10.1016/S0140-6736(86)91340-1.
Barker D. J., Osmond C. (1988). Low birth weight and hypertension. 297 134–135. 10.1136/bmj.297.6641.134-b.
Binns, C., Lee, M., & Low, W. Y. (2016). The long-term public health benefits of breastfeeding. Asia Pacific Journal of Public Health28(1), 7-14.
Blazy H., (2012) Gespräche im Innenraum. Mattes. Heidelberg
Blechschmidt, E. (2002). Wie beginnt das menschliche Leben: vom Ei zum Embryo; Befunde und Konsequenzen. Christiana-Verlag.
Bowatte, G., Tham, R., Allen, K. J., Tan, D. J., Lau, M. X. Z., Dai, X., & Lodge, C. J. (2015). Breastfeeding and childhood acute otitis media: a systematic review and meta‐analysis. Acta Paediatrica104(S467), 85-95.
Briffa, J. F., Wlodek, M. E., & Moritz, K. M. (2018, June). Transgenerational programming of nephron deficits and hypertension. In Seminars in cell & developmental biology. Academic Press.
Cantrill, R. M., Creedy, D. K., Cooke, M., & Dykes, F. (2014). Effective suckling in relation to naked maternal-infant body contact in the first hour of life: an observation study. BMC pregnancy and childbirth14(1), 20.
Cao-Lei, L., Massart, R., Suderman, M. J., Machnes, Z., Elgbeili, G., Laplante, D. P., … & King, S. (2014). DNA methylation signatures triggered by prenatal maternal stress exposure to a natural disaster: project ice storm. PLoS One,9(9), e107653.
Castellino R. (2000) Bindungsprozesse von Neugeborenen und Eltern bei der Geburt. In: Harms, T. (2000). Auf die Welt gekommen. Leutner, Berlin.
Champagne, F. A., Weaver, I. C., Diorio, J., Dymov, S., Szyf, M., & Meaney, M. J. (2006). Maternal care associated with methylation of the estrogen receptor-α1b promoter and estrogen receptor-α expression in the medial preoptic area of female offspring. Endocrinology147(6), 2909-2915.
Champagne, F. A., & Curley, J. P. (2009). Epigenetic mechanisms mediating the long-term effects of maternal care on development. Neuroscience & Biobehavioral Reviews33(4), 593-600.
Chen, E. M., Gau, M. L., Liu, C. Y., & Lee, T. Y. (2017). Effects of Father-Neonate Skin-to-Skin Contact on Attachment: A Randomized Controlled Trial. Nursing research and practice. 2017.
Chiba, H., Hiura, H., Okae, H., Miyauchi, N., Sato, F., Sato, A., & Arima, T. (2013). DNA methylation errors in imprinting disorders and assisted reproductive technology. Pediatrics International55(5), 542-549.
Cleveland, L., Hill, C. M., Pulse, W. S., DiCioccio, H. C., Field, T., & White-Traut, R. (2017). systematic Review of Skin-to-skin Care for Full-term, Healthy Newborns. Journal of Obstetric, Gynecologic & Neonatal Nursing46(6), 857-869.7.
Cortessis, V. K., Azadian, M., Buxbaum, J., Sanogo, F., Song, A. Y., Sriprasert, I., … & Siegmund, K. D. (2018). Comprehensive meta-analysis reveals association between multiple imprinting disorders and conception by assisted reproductive technology. Journal of assisted reproduction and genetics, 1-10.
Dahlen, H. G., Downe, S., Wright, M. L., Kennedy, H. P., & Taylor, J. Y. (2016). Childbirth and consequent atopic disease: emerging evidence on epigenetic effects based on the hygiene and EPIIC hypotheses. BMC pregnancy and childbirth16(1), 1.
Davis, E. P., Glynn, L. M., Waffarn, F., & Sandman, C. A. (2011). Prenatal maternal stress programs infant stress regulation. Journal of Child Psychology and Psychiatry52(2), 119-129.
Davis, M., West, K., Bilms, J., Morelen, D., & Suveg, C. (2018). A systematic review of parent–child synchrony: It is more than skin deep. Developmental psychobiology.
de Graaff, L. F., Honig, A., van Pampus, M. G., & Stramrood, C. A. (2018). Preventing post‐traumatic stress disorder following childbirth and traumatic birth experiences: a systematic review. Acta obstetricia et gynecologica Scandinavica97(6), 648-656.
Dias, B. G., & Ressler, K. J. (2014). Parental olfactory experience influences behavior and neural structure in subsequent generations. Nature neuroscience,17(1), 89-96.
Elenis, E., Svanberg, A. S., Lampic, C., Skalkidou, A., Åkerud, H., & Sydsjö, G. (2015). Adverse obstetric outcomes in pregnancies resulting from oocyte donation: a retrospective cohort case study in Sweden. BMC pregnancy and childbirth15(1), 1.
Entringer, S., Kumsta, R., Hellhammer, D. H., Wadhwa, P. D., & Wüst, S. (2009). Prenatal exposure to maternal psychosocial stress and HPA axis regulation in young adults. Hormones and behavior55(2), 292-298.
Fauser, B. C. J. M., Devroey, P., Diedrich, K., Balaban, B., Bonduelle, M., Delemarre-Van De Waal, H. A., … & Lerner-Geva, L. (2014). Health outcomes of children born after IVF/ICSI: a review of current expert opinion and literature. Reproductive biomedicine online28(2), 162-182.
Fazeli, A. (2008). Maternal communication with gametes and embryos. Theriogenology70(8), 1182-1187.
Fazeli A. & Holt W.V. (2016) Cross talk during the periconception period. Theriogenology, 86(1) 438–442.
Fazeli A. & Pewsey E. (2008) Maternal communication with gametes and embryos: a complex interactome. Briefings in functional genomics & proteomics. 7(2): 111–118.
Feldman R. (2007) Parent-infant synchrony: Biological foundations and developmental outcomes. Current Directions in Psychological Science 16: 340–345.
Filippetti M.L., Johnson M.H., Lloyd-Fox S., Dragovic D. & Farroni T. (2013) Body perception in newborns. Current Biology, 23(23) 2413-2416.
Flanigan, C., Sheikh, A., DunnGalvin, A., Brew, B. K., Almqvist, C., & Nwaru, B. I. (2018). Prenatal maternal psychosocial stress and offspring’s asthma and allergic disease: a systematic review and meta‐analysis. Clinical & Experimental Allergy.
Fleming, T. P., Watkins, A. J., Velazquez, M. A., Mathers, J. C., Prentice, A. M., Stephenson, J., … & Hanson, M. A. (2018). Origins of lifetime health around the time of conception: causes and consequences. The Lancet.
Fraley, R. C., & Spieker, S. J. (2003). Are infant attachment patterns continuously or categorically distributed? A taxometric analysis of strange situation behavior. Developmental psychology39(3), 387.
Glover, V. (2014). Maternal depression, anxiety and stress during pregnancy and child outcome; what needs to be done. Best practice & research Clinical obstetrics & gynaecology28(1), 25-35.
Gluckman, P. D., Hanson, M. A., & Beedle, A. S. (2007). Early life events and their consequences for later disease: a life history and evolutionary perspective. American Journal of Human Biology19(1), 1-19.
Gluckman, P. D., Hanson, M. A., Cooper, C., & Thornburg, K. L. (2008). Effect of in utero and early-life conditions on adult health and disease. New England Journal of Medicine359(1), 61-73.
Golding, J., Pembrey, M., & Jones, R. (2001). ALSPAC-the Avon longitudinal study of parents and children. I. Study methodology. Paediatric and perinatal epidemiology15(1), 74-87.
Gómez-Torres M.J., García E.M., Guerrero J., Medina S., Izquierdo-Rico M.J., Gil-Izquierdo Á., Bernabeu R. (2015)  Metabolites involved in cellular communication among human cumulus-oocyte-complex and sperm during in vitro fertilization. Reproductive Biology and Endocrinology, 13(1): 1.
Guerrero-Bosagna, C., & Skinner, M. K. (2012). Environmentally induced epigenetic transgenerational inheritance of phenotype and disease. Molecular and cellular endocrinology354(1), 3-8.
Guo, X. Y., Liu, X. M., Jin, L., Wang, T. T., Ullah, K., Sheng, J. Z., & Huang, H. F. (2017). Cardiovascular and metabolic profiles of offspring conceived by assisted reproductive technologies: a systematic review and meta-analysis. Fertility and sterility107(3), 622-631.
Hall, W. A., Stoll, K., Hutton, E. K., & Brown, H. (2012). A prospective study of effects of psychological factors and sleep on obstetric interventions, mode of birth, and neonatal outcomes among low-risk British Columbian women. BMC pregnancy and childbirth12(1), 1.
Hart, R., & Norman, R. J. (2013). The longer-term health outcomes for children born as a result of IVF treatment: Part I–General health outcomes. Human reproduction update19(3), 232-243.
Hartwig, F. P., de Mola, C. L., Davies, N. M., Victora, C. G., & Relton, C. L. (2017). Breastfeeding effects on DNA methylation in the offspring: A systematic literature review. PloS one12(3), e0173070.
Heard, E., & Martienssen, R. A. (2014). Transgenerational epigenetic inheritance: myths and mechanisms. Cell157(1), 95-109.
Heijmans, B. T., Tobi, E. W., Stein, A. D., Putter, H., Blauw, G. J., Susser, E. S., … Lumey, L. H. (2008). Persistent epigenetic differences associated with prenatal exposure to famine in humans. Proceedings of the National Academy of Sciences of the United States of America105(44), 17046–17049.
Heindel, J. J., Skalla, L. A., Joubert, B. R., Dilworth, C. H., & Gray, K. A. (2017). Review of developmental origins of health and disease publications in environmental epidemiology. Reproductive Toxicology68, 34-48.
Henriksen, R. E., & Thuen, F. (2015). Marital Quality and Stress in Pregnancy Predict the Risk of Infectious Disease in the Offspring: The Norwegian Mother and Child Cohort Study. PloS one10(9), e0137304.
Hillenhinrichs, A. (2017) Das menschliche Herz. Studienarbeit, Carl Gustav Carus Akademie, Hamburg.
Hiura, Hitoshi, et al. “Characterization of DNA methylation errors in patients with imprinting disorders conceived by assisted reproduction technologies.” Human Reproduction 27.8 (2012): 2541-2548.
Horta, B. L., Loret de Mola, C., & Victora, C. G. (2015a). Long‐term consequences of breastfeeding on cholesterol, obesity, systolic blood pressure and type 2 diabetes: a systematic review and meta‐analysis. Acta Paediatrica104(S467), 30-37
Horta, B. L., Loret de Mola, C., & Victora, C. G. (2015b). Breastfeeding and intelligence: a systematic review and meta‐analysis. Acta paediatrica104(S467), 14-19.
James, S. (2015) Women’s experiences of symptoms of posttraumatic stress disorder (PTSD) after traumatic childbirth: a review and critical appraisal. Archives of women’s mental health 18.6: 761-771.
Jealous J. (2015) An osteopathic Odyssey. Direction of Ease LLC.
Jiang, Z., Wang, Y., Lin, J., Xu, J., Ding, G., & Huang, H. (2017). Genetic and epigenetic risks of assisted reproduction. Best Practice & Research Clinical Obstetrics & Gynaecology.
Kaartinen, N., & Tinkanen, H. (2017). Do in vitro fertilization treatments result in healthy babies?. Duodecim; laaketieteellinen aikakauskirja133(8), 728-734.
Khan, J., Vesel, L., Bahl, R., & Martines, J. C. (2015). Timing of breastfeeding initiation and exclusivity of breastfeeding during the first month of life: effects on neonatal mortality and morbidity—a systematic review and meta-analysis. Maternal and child health journal19(3), 468-479
King, S., Dancause, K., Turcotte‐Tremblay, A. M., Veru, F., & Laplante, D. P. (2012). Using natural disasters to study the effects of prenatal maternal stress on child health and development. Birth Defects Research Part C: Embryo Today: Reviews96(4), 273-288.  82
Kochanski, A., Merritt, T. A., Gadzinowski, J., & Jopek, A. (2013). The impact of assisted reproductive technologies on the genome and epigenome of the newborn. Journal of neonatal-perinatal medicine6(2), 101-108.
Korja, R., Nolvi, S., Grant, K. A., & McMahon, C. (2017). The relations between maternal prenatal anxiety or stress and child’s early negative reactivity or self-regulation: a systematic review. Child Psychiatry & Human Development48(6), 851-869.
Lakoff, G. (2008). Women, fire, and dangerous things. University of Chicago press.
Laplante, D. P., Hart, K. J., O’Hara, M. W., Brunet, A., & King, S. (2018). Prenatal maternal stress is associated with toddler cognitive functioning: The Iowa Flood Study. Early human development116, 84-92.:
Lazaraviciute, G., Kauser, M., Bhattacharya, S., Haggarty, P., & Bhattacharya, S. (2014). A systematic review and meta-analysis of DNA methylation levels and imprinting disorders in children conceived by IVF/ICSI compared with children conceived spontaneously. Human reproduction update20(6), 840-852.
Lehnert, H., Henriette, K., Kirmes, I., & Dahm, R. (2018). Epigenetik-Grundlagen und klinische Bedeutung: Aus der Vortragsreihe der Medizinischen Gesellschaft Mainz eV. Springer-Verlag.
Machtinger, R., Laurent, L. C., & Baccarelli, A. A. (2015). Extracellular vesicles: roles in gamete maturation, fertilization and embryo implantation. Human reproduction update22(2), 182-193.
Maleszka, R. (2008). Epigenetic integration of environmental and genomic signals in honey bees. The critical interplay of nutritional, brain and reproductive networks. Epigenetics 3(4), 188–192.
Malina, A., & Pooley, J. A. (2017). Psychological consequences of IVF fertilization–Review of research. Annals of Agricultural and Environmental Medicine24(4), 554-558.
Martos, S. N., Tang, W., & Wang, Z. (2015). Elusive inheritance: Transgenerational effects and epigenetic inheritance in human environmental disease. Progress in Biophysics and Molecular Biology118(1-2), 44–54. http://doi.org/10.1016/j.pbiomolbio.2015.02.011
Melnik, B. C., John, S. M., & Schmitz, G. (2013). Milk is not just food but most likely a genetic transfection system activating mTORC1 signaling for postnatal growth. Nutrition Journal12, 103. http://doi.org/10.1186/1475-2891-12-103.
Menche, N. (2003). Biologie Anatomie Physiologie. Kompaktes Lehrbuch für Pflegeberufe. 5. überarbeitete Auflage. Urban & Fischer Verlag, München Jena.
Monk, C., Feng, T., Lee, S., Krupska, I., Champagne, F. A., & Tycko, B. (2016). Distress During Pregnancy: Epigenetic Regulation of Placenta Glucocorticoid-Related Genes and Fetal Neurobehavior. The American Journal of Psychiatry173(7), 705–713.
Monk, C., Spicer, J., & Champagne, F. A. (2012). Linking Prenatal Maternal Adversity to Developmental Outcomes in Infants: The Role of Epigenetic Pathways. Development and Psychopathology24(4), 1361–1376.
Monk, D. (2015). Germline-derived DNA methylation and early embryo epigenetic reprogramming: the selected survival of imprints. The international journal of biochemistry & cell biology67, 128-138.
Moore, E. R., Anderson, G. C., Bergman, N., & Dowswell, T. (2012). Early skin-to-skin contact for mothers and their healthy newborn infants. The Cochrane Database of Systematic Reviews5, CD003519.
Moore, E. R., Bergman, N., Anderson, G. C., & Medley, N. (2016). Early skin‐to‐skin contact for mothers and their healthy newborn infants. The Cochrane Database of Systematic Review,11,1-109.
Murgatroyd, C., Quinn, J. P., Sharp, H. M., Pickles, A., & Hill, J. (2015). Effects of prenatal and postnatal depression, and maternal stroking, at the glucocorticoid receptor gene. Translational psychiatry5(5), e560
Murphy, H., & Strong, J. (2018). Just another ordinary bad birth? A narrative analysis of first time mothers’ traumatic birth experiences. Health care for women international, 1-25.
Nemoda, Z., & Szyf, M. (2017). Epigenetic Alterations and Prenatal Maternal Depression. Birth defects research109(12), 888-897.
Nilsson, E. E., & Skinner, M. K. (2015). Environmentally induced epigenetic transgenerational inheritance of disease susceptibility. Translational Research165(1), 12-17.
Nilsson, E. E., & Skinner, M. K. (2015). Environmentally Induced Epigenetic Transgenerational Inheritance of Reproductive Disease. Biology of reproduction93(6), 145
Ortiz, J., Paredes, D., Neira, R., & Galvez, P. (2017). Epigenetic and Birth. MOJ Womens Health4(1), 00072.
Pakter, R., & Levin, Y. (2018). Stability and self-organization of planetary systems. Physical Review E97(4), 042221.
Patel, A., Bucher, S., Pusdekar, Y., Esamai, F., Krebs, N. F., Goudar, S. S., … & Kodkany, B. S. (2015). Rates and determinants of early initiation of breastfeeding and exclusive breast feeding at 42 days postnatal in six low and middle-income countries: A prospective cohort study. Reproductive health12(2), S10.
Patil, A. S., Nguyen, C., Groff, K., Wu, J., Elliott, J., & Gunatilake, R. P. (2018). Severity of congenital heart defects associated with assisted reproductive technologies: Case series and review of the literature. Birth defects research110(8), 654-661.
Pembrey, M. E., Bygren, L. O., Kaati, G., Edvinsson, S., Northstone, K., Sjöström, M., & Golding, J. (2006). Sex-specific, male-line transgenerational responses in humans. European journal of human genetics14(2), 159.
Peres, K. G., Cascaes, A. M., Nascimento, G. G., & Victora, C. G. (2015). Effect of breastfeeding on malocclusions: a systematic review and meta‐analysis. Acta Paediatrica104, 54-61.
Pérez‐Escamilla, R., Martinez, J. L., & Segura‐Pérez, S. (2016). Impact of the Baby‐friendly Hospital Initiative on breastfeeding and child health outcomes: a systematic review. Maternal & child nutrition12(3), 402-417.
Peters, L. L., Thornton, C., de Jonge, A., Khashan, A., Tracy, M., Downe, S., … & Dahlen, H. G. (2018). The effect of medical and operative birth interventions on child health outcomes in the first 28 days and up to 5 years of age: A linked data population‐based cohort study. Birth: 1-11.
Phillips, R. (2013). The sacred hour: Uninterrupted skin-to-skin contact immediately after birth. Newborn and Infant Nursing Reviews13(2), 67-72.
Preston, J. D., Reynolds, L. J., & Pearson, K. J. (2018). Developmental Origins of Health Span and Life Span: A Mini-Review. Gerontology.
Ramborger, M. E., Zubilete, M. A. Z., & Acosta, G. B. Prenatal Stress and its effects of human cognition, behavior and psychopathology: A review of the literature.
Raffai, J., & Hidas, G. (2006). Nabelschnur der Seele (The Soul’s Umbilical Cord). Giessen, Germany: Psychosozial-Verlag.
Rixgens, N. (2017) Klarheit durch Frieden in mir selbst. CD.
Rochat, P. (2012). Primordial sense of embodied self-unity. Early development of body representations, 3-18.
Sankar, M. J., Sinha, B., Chowdhury, R., Bhandari, N., Taneja, S., Martines, J., & Bahl, R. (2015). Optimal breastfeeding practices and infant and child mortality: a systematic review and meta‐analysis. Acta paediatrica104(S467), 3-13.
Schumacher, K., & Calvet, C. (2008). Synchronisation/Synchronization–Musiktherapie bei Kindern mit Autismus/Music Therapy with Children in the Autistic Spectrum. Unter Mitarbeit von Manfred Hüneke und Petra Kugel. 16 Seiten mit DVD-Box.
Sendker, J. P. (2012). Das Herzenhören: Roman (Vol. 1). Heyne Verlag.
Simpson, M., Schmied, V., Dickson, C., & Dahlen, H. G. (2018). Postnatal post-traumatic stress: An integrative review. Women and Birth.
Shufaro, Y., & Laufer, N. (2013). Epigenetic concerns in assisted reproduction: update and critical review of the current literature. Fertility and sterility99(3), 605-606.
Sosnowski, D. W., Booth, C., York, T. P., Amstadter, A. B., & Kliewer, W. (2018). Maternal prenatal stress and infant DNA methylation: A systematic review. Developmental psychobiology.
Stegemann, R., & Buchner, D. A. (2015). Transgenerational inheritance of metabolic disease. In Seminars in cell & developmental biology (Vol. 43, pp. 131-140). Academic Press.
Stevens, J., Schmied, V., Burns, E., & Dahlen, H. (2014). Immediate or early skin‐to‐skin contact after a Caesarean section: a review of the literature. Maternal & child nutrition10(4), 456-473.
Sutherland, W. G. (2008). Das große Sutherland-Kompendium(Vol. 2). JOLANDOS eK.
Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. cell126(4), 663-676.
Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872.
Tham, R., Bowatte, G., Dharmage, S. C., Tan, D. J., Lau, M. X. Z., Dai, X., … & Lodge, C. J. (2015). Breastfeeding and the risk of dental caries: a systematic review and meta‐analysis. Acta Paediatrica104(S467), 62-84.
Thelen, E., & Smith, L. B. (1996). A dynamic systems approach to the development of cognition and action. MIT press.
Thelen, E., Schöner, G., Scheier, C., & Smith, L. B. (2001). The dynamics of embodiment: A field theory of infant perseverative reaching. Behavioral and brain sciences24(1), 1-34.
Uvnas-Moberg, K. (2015). Oxytocin: the biological guide to motherhood. Amarillo, TX: Hale Publishing.
van Camp W (2015) persönliche Mitteilung, Swiss Osteopathic Center for Kids (SOCK). Crans Montana 2015.
Van den Bergh, B. R., van den Heuvel, M. I., Lahti, M., Braeken, M., de Rooij, S. R., Entringer, S., … & Schwab, M. (2017). Prenatal developmental origins of behavior and mental health: The influence of maternal stress in pregnancy. Neuroscience & Biobehavioral Reviews.
van der Wal, J., & Glöckler, M. (2003). Dynamische Morphologie und Entwicklung der menschlichen Gestalt. Dornach: Freie Hochschule für Geisteswissenschaften.
Ventura-Juncá, P., Irarrázaval, I., Rolle, A. J., Gutiérrez, J. I., Moreno, R. D., & Santos, M. J. (2015). In vitro fertilization (IVF) in mammals: epigenetic and developmental alterations. Scientific and bioethical implications for IVF in humans. Biological research48(1),1.
Verduci, E., Banderali, G., Barberi, S., Radaelli, G., Lops, A., Betti, F., … Giovannini, M. (2014). Epigenetic Effects of Human Breast Milk. Nutrients6(4), 1711–1724.
Vesel, J., & Nickasch, B. (2016). An Evidence Review and Model for Prevention and Treatment of Postpartum Posttraumatic Stress Disorder.Nursing for women’s health19(6), 504-525.
Verdult R (2014) Pränatale Bindungsentwicklung – auf dem Weg zu einer pränatalen Entwicklungspsychologie. In Evertz, K., Janus, L., & Linder, R. (Eds.). (2014). Lehrbuch der Pränatalen Psychologie. Mattes Vlg.
Victora, C. G., Bahl, R., Barros, A. J., França, G. V., Horton, S., Krasevec, J., … & Rollins, N. C. (2016). Breastfeeding in the 21st century: epidemiology, mechanisms, and lifelong effect. The Lancet387(10017), 475-490.
Vittner, D., McGrath, J., Robinson, J., Lawhon, G., Cusson, R., Eisenfeld, L., … & Cong, X. (2018). Increase in Oxytocin From Skin-to-Skin Contact Enhances Development of Parent–Infant Relationship. Biological research for nursing20(1), 54-62.
Wambach, K., & Riordan, J. (Eds.). (2014). Breastfeeding and human lactation. Jones & Bartlett Learning.
Wang, Y., Jorda, M., Jones, P. L., Maleszka, R., Ling, X., Robertson, H. M., et al. (2006). Functional CpG methylation system in a social insect. Science, 314(5799), 645-647.
Weaver, I. C., Cervoni, N., Champagne, F. A., D’Alessio, A. C., Sharma, S., Seckl, J. R., … & Meaney, M. J. (2004). Epigenetic programming by maternal behavior. Nature neuroscience7(8), 847-854.
Widstro¨m AM, Ransjo¨ -Arvidson AB, Christensson K, Matthiesen AS, Winberg J, Uvna¨ s-Moberg K. Gastric suction in healthy newborn infants. Effects on circulation and developing feeding behaviour. Acta Paediatr Scand 1987; 76: 566–72.
Widström, A. M., Lilja, G., Aaltomaa‐Michalias, P., Dahllöf, A., Lintula, M., & Nissen, E. (2011). Newborn behaviour to locate the breast when skin‐to‐skin: a possible method for enabling early self‐regulation. Acta paediatrica100(1), 79-85.
Wolf, E., Arnold, G. J., Bauersachs, S., Beier, H. M., Blum, H., Einspanier, R., … & Prelle, K. (2003). Embryo‐maternal communication in bovine–strategies for deciphering a complex cross‐talk. Reproduction in Domestic Animals38(4), 276-289.
World Health Organization & United Nations Children’s Fund (2009) Baby-friendly hospital initiative. http://www.who.int/nutrition/publications/infantfeeding/bfhi_trainingcourse/en/, letzter Zugriff 23.6.18.
World Health Organization (2016). Early initiation of breastfeeding to promote exclusive breastfeeding. http://www.who.int/elena/titles/early_breastfeeding/en/, letzter Zugriff 23.6.2018.
Yamanaka, S. (2012). Induced pluripotent stem cells: past, present, and future. Cell stem cell10(6), 678-684.
Yildiz, P. D., Ayers, S., & Phillips, L. (2017). The prevalence of posttraumatic stress disorder in pregnancy and after birth: a systematic review and meta-analysis. Journal of affective disorders208, 634-645.
Yin, L., Chung, C. M., Huo, R., Liu, H., Zhou, C., Xu, W., … & Chen, J. (2009). A sperm GPI-anchored protein elicits sperm-cumulus cross-talk leading to the acrosome reaction. Cellular and Molecular Life Sciences66(5), 900-908.
Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., et al. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917–1920.
Zheng, Z., Chen, L., Yang, T., Yu, H., Wang, H., & Qin, J. (2018). Multiple pregnancies achieved with IVF/ICSI and risk of specific congenital malformations: a meta-analysis of cohort studies. Reproductive biomedicine online.
Zijlmans, M. A., Riksen-Walraven, J. M., & de Weerth, C. (2015). Associations between maternal prenatal cortisol concentrations and child outcomes: A systematic review. Neuroscience & Biobehavioral Reviews53, 1-24. 47.